Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 6DS_2090378

[Submit comment/correction]

Sequence	wsnp_Ex_c30852_39718945
Contig	6DS_2090378
Probe	wsnp_Ex_c30852_39718945
DNA Homology	6DS_2090378 Best IWGSC match 143 1e-31 URGI_Best IWGSC_N
BLAST, e-value	1e-31 6DS_2090378 Best IWGSC match
DNA	cggagacgatccagctcccctggaagccctcgtcgaaggactcgtgaaac agcggatccgacgcgtagatctgcgcgaacagcgccgagaccaccagcag Ragcaccgcgcgcccgcccgtcatcctcctcctccccgacccgatctctc tgcgagcgcaaccggaacaactggagtagtsccccgc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.