Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IAAV1711

[Submit comment/correction]

Sequence	IAAV1711
Contig	6DS_2068951
Probe	IAAV1711
DNA Homology	6DS_2068951 Best IWGSC match 291 0 URGI_Best IWGSC_N
BLAST, e-value	0 6DS_2068951 Best IWGSC match
DNA	nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngcaactgacgt atttgcatgccacctggtgccaagagacggagaccaatctggaggataac Rttttgcatggcatagtcactagtaacacacgcaacagtagattcagata aggacctcagggcccaactctgctcactgctctcatcatctacaaaagat g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.