Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RFL_Contig4975_892

[Submit comment/correction]

Sequence	RFL_Contig4975_892
Contig	6DL_1584732
Probe	RFL_Contig4975_892
DNA Homology	6DL_1584732 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 6DL_1584732 Best IWGSC match
DNA	aaagcctagctcgaccttggtcgttgccggcgtcgacggcgtcctaggac Rtcgttccctccttggaggcgtcgtcgtggagccccttcaccaccattgt c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.