Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c63713_892

[Submit comment/correction]

Sequence	Excalibur_c63713_892
Contig	6DL_3279849
Probe	Excalibur_c63713_892
DNA Homology	6DL_3279849 Best IWGSC match 154 2e-35 URGI_Best IWGSC_N
BLAST, e-value	2e-35 6DL_3279849 Best IWGSC match
DNA	cgaagcaggcaagacccatagcaggatcctcagtgctccatcgccagcac Rcaccgcaggcagccgccttcatgcagcaggtcgaacgccttgttgatat c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.