Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CAP8_c2210_66

[Submit comment/correction]

Sequence	CAP8_c2210_66
Contig	6DL_2225069
Probe	CAP8_c2210_66
DNA Homology	6DL_2225069 Best IWGSC match 165 1e-38 URGI_Best IWGSC_N
BLAST, e-value	1e-38 6DL_2225069 Best IWGSC match
DNA	ccaaaccagccgagcctgtctgccatcaggtgcaggttgttgcagccccc Rcagcgggcgaccaccaccccgttgtcgtacgagtcccggccgtaaggta c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.