Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c2737_309

[Submit comment/correction]

Sequence	Excalibur_c2737_309
Contig	6DL_2023355
Probe	Excalibur_c2737_309
DNA Homology	6DL_2023355 Best IWGSC match 172 7.00005e-41 URGI_Best IWGSC_N
BLAST, e-value	7.00005e-41 6DL_2023355 Best IWGSC match
DNA	ctcaagagcctgagcgggccggtgtcggcgaccctctacctcggctactc Rctcttcatggtcatcgccatcatgctggccacgggcacggtcgggttca t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.