GrainGenes Sequence Report: 1AL_3976711
Sequence
BS00065700_51
Contig
1AL_3976711
Probe
BS00065700_51
DNA Homology
1AL_3976711 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value
2.94273e-44 1AL_3976711 Best IWGSC match
DNA
tcccattgaactagccattgaaccaccggcaaattgttgcgtggaacctg
Rcgtgtttccaagacccacactggctcagtctgaatcataccatcttctc
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3976711
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
