Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 6DS_2110264

[Submit comment/correction]

Sequence	Excalibur_c21342_215
Contig	6DS_2110264
Probe	Excalibur_c21342_215
DNA Homology	6DS_2110264 Best IWGSC match 176 4.99983e-42 URGI_Best IWGSC_N
BLAST, e-value	4.99983e-42 6DS_2110264 Best IWGSC match
DNA	aggcccagcgtcatggttgggaatgcactttactggttgctctctggagc Maacatccttgagtttgatttttgaaaggcagacccttgttgtgattgag a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.