Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c6326_61

[Submit comment/correction]

Sequence	Excalibur_c6326_61
Contig	6AS_4363570
Probe	Excalibur_c6326_61
DNA Homology	6AS_4363570 Best IWGSC match 171 2e-40 URGI_Best IWGSC_N
BLAST, e-value	2e-40 6AS_4363570 Best IWGSC match
DNA	caccactgctgctgcctaagatgttcaccaagaaggctgaaaccgctacc Rcacctgaagaggccgcggctgccaagcgagctgcagccaagtctaccgc t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.