GrainGenes Sequence Report: Kukri_c24454_286
Sequence
Kukri_c24454_286
Contig
1AS_1516933
Probe
Kukri_c24454_286
DNA Homology
1AS_1516933 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value
1.00053e-42 1AS_1516933 Best IWGSC match
DNA
tcagtatatccaattcactgctcgacttgctgagcttatgaggagcagca
Rctgctgttctgctgctgtatgggctggcctttcatgtgaacatggaccg
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Kukri_c24454_286
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
