Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 6BS_672118

[Submit comment/correction]

Sequence	IACX8154
Contig	6BS_672118
Probe	IACX8154
DNA Homology	6BS_672118 Best IWGSC match 351 0 URGI_Best IWGSC_N
BLAST, e-value	0 6BS_672118 Best IWGSC match
DNA	ccaggagcagcctatgggcagaaaggaggatctcccgttggtcggctgcc aggttccctaccaccgtgtgccttgcaaagtgggactgcagcagggcgtt Sgccttgacatgtggatcaccatacttgggtttgtcaatagaaaacctct ggtgacggactagcctctcaatgtattcctcttcgcctgggcgacttgga a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.