Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c54392_94

[Submit comment/correction]

Sequence	RAC875_c54392_94
Contig	5BL_10896979
Probe	RAC875_c54392_94
DNA Homology	5BL_10896979 Best IWGSC match 171 2e-40 URGI_Best IWGSC_N
BLAST, e-value	2e-40 5BL_10896979 Best IWGSC match
DNA	tcctggtttttccttgctgccaagtctcgatttatcaagaatgctgaaaa Rgctgctgatctccagaactatgtattgtgcgttgagatgctcatagcag c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.