Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IACX7841

[Submit comment/correction]

Sequence	IACX7841
Contig	5BL_10851295
Probe	IACX7841
DNA Homology	5BL_10851295 Best IWGSC match 189 1.4013e-45 URGI_Best IWGSC_N
BLAST, e-value	1.4013e-45 5BL_10851295 Best IWGSC match
DNA	aggtacccaaactctgctgcaattctcaagaccgaagatgcttctgggtc tccaagtcgaggcatcctaaatcctgttgtactagatcgcctgaaaaact Rtcttgttcggatggagggaccaaggcggacggtgttgtcggtccggcga gccggcgggtgg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.