Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 5BL_10803581

[Submit comment/correction]

Sequence	tplb0045g14_708
Contig	5BL_10803581
Probe	tplb0045g14_708
DNA Homology	5BL_10803581 Best IWGSC match 150 3e-34 URGI_Best IWGSC_N
BLAST, e-value	3e-34 5BL_10803581 Best IWGSC match
DNA	tgagaggccagggactccagagccactatgccaagtgatgcttcgtgtcg Rtgatctcgaccgagccataagcttttacgagaaggcttgtggtatgaaa c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.