Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IAAV2421

[Submit comment/correction]

Sequence	IAAV2421
Contig	5BL_10887652
Probe	IAAV2421
DNA Homology	5BL_10887652 Best IWGSC match 235 0 URGI_Best IWGSC_N
BLAST, e-value	0 5BL_10887652 Best IWGSC match
DNA	nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnncgggcgggtctgaaaatgttcctgtggagagc Rcgaaatgcgcgaccggctcggaatggtgaagggcgtaagggtgcctcgg cgtcgaccctgccagggatctttttgctggcgtgaacagcgcgcgaaccc n

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.