Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c2506_332

[Submit comment/correction]

Sequence	BobWhite_c2506_332
Contig	1AL_3883759
Probe	BobWhite_c2506_332
DNA Homology	1AL_3883759 Best IWGSC match 113 4e-23 URGI_Best IWGSC_N
BLAST, e-value	4e-23 1AL_3883759 Best IWGSC match
DNA	gacgcagatagctgcccctgagcagagaacgacgagtgcgcccatagatc Rcgagcggtgacggacgcggaccccggaagcccgacgtttgaccagtgtg c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.