Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: JD_c947_819

[Submit comment/correction]

Sequence	JD_c947_819
Contig	5DS_2738988
Species	Triticum aestivum
Probe	JD_c947_819
DNA Homology	5DS_2738988 Best IWGSC match 172 7.00005e-41 URGI_Best IWGSC_N
BLAST, e-value	7.00005e-41 5DS_2738988 Best IWGSC match
DNA	tgagactaaacagcagtagcaactggagtgtcggggtgagcaccccattc Rgtccatgatccatcgtacacggcaacatcagttttgccgaggcggtgaa g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.