Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RFL_Contig4979_4240

[Submit comment/correction]

Sequence	RFL_Contig4979_4240
Contig	5BS_1635726
Probe	RFL_Contig4979_4240
DNA Homology	5BS_1635726 Best IWGSC match 117 3e-24 URGI_Best IWGSC_N
BLAST, e-value	3e-24 5BS_1635726 Best IWGSC match
DNA	tcttgcagaatttccacatgcaagctttttacatacggtagaaactgctg Mtgactctgctccactgttttcattgctggcaccacttggtagtggagtg c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.