Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RFL_Contig3674_847

[Submit comment/correction]

Sequence	RFL_Contig3674_847
Contig	5AS_1522100
Probe	RFL_Contig3674_847
DNA Homology	5AS_1522100 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 5AS_1522100 Best IWGSC match
DNA	aggatgtcaaggaacgcagatggcgcgacggccctgaaccggtgcatgtt Rcctcccgccgtcgggaacaggaccgacgtgtcgcacggcgctgtgaaaa c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.