Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-4360_462

[Submit comment/correction]

Sequence	GENE-4360_462
Contig	5AS_1550205
Probe	GENE-4360_462
DNA Homology	5AS_1550205 Best IWGSC match 171 2e-40 URGI_Best IWGSC_N
BLAST, e-value	2e-40 5AS_1550205 Best IWGSC match
DNA	caatggttcattcatgtacgggtgcaggaaaaaatgatcgagccggcggt Raacgggacgagaaargtgatcaacgccgcggcggaggtgggcggca

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.