Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_rep_c111708_568

[Submit comment/correction]

Sequence	Excalibur_rep_c111708_568
Contig	5DS_2763112
Probe	Excalibur_rep_c111708_568
DNA Homology	5DS_2763112 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 5DS_2763112 Best IWGSC match
DNA	actggcaagtgcattgccaagattgcagcgaatgatcctgcccttagtat Mgcccctcgcaagaatggtagcccttcaatctggagtagtatcccagaag c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.