Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CAP11_c2248_250

[Submit comment/correction]

Sequence	CAP11_c2248_250
Contig	4BS_4927383
Probe	CAP11_c2248_250
DNA Homology	4BS_4927383 Best IWGSC match 163 4e-38 URGI_Best IWGSC_N
BLAST, e-value	4e-38 4BS_4927383 Best IWGSC match
DNA	ttacggccgggaggagacgtggtacgagcgctacccgcatttcggcttcc Rccactgcttcgagaactcggtgcaactattgtccgttcccaggcagcct c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.