Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_RFL_Contig2216_1587922

[Submit comment/correction]

Sequence	wsnp_RFL_Contig2216_1587922
Contig	4DS_1165433
Probe	wsnp_RFL_Contig2216_1587922
DNA Homology	4DS_1165433 Best IWGSC match 163 4e-38 URGI_Best IWGSC_N
BLAST, e-value	4e-38 4DS_1165433 Best IWGSC match
DNA	cctgctactctcctgatttctttcatacaacatgtgattctttgtgaagt Rtttataagtatcacgcccctgtgcaagcatggcttgttctatggaacca a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.