Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c12246_766

[Submit comment/correction]

Sequence	Excalibur_c12246_766
Contig	5AL_2803118
Probe	Excalibur_c12246_766
DNA Homology	5AL_2803118 Best IWGSC match 152 8e-35 URGI_Best IWGSC_N
BLAST, e-value	8e-35 5AL_2803118 Best IWGSC match
DNA	ccgccggtgtagtggaacgctccgtcttcggtgtccctgtcgaaccatct Mggtttccatccattatcctgcattttccgtgccatccgttgccttgtct c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.