Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_rep_c99503_99

[Submit comment/correction]

Sequence	Excalibur_rep_c99503_99
Contig	4BL_7039351
Probe	Excalibur_rep_c99503_99
DNA Homology	4BL_7039351 Best IWGSC match 154 2e-35 URGI_Best IWGSC_N
BLAST, e-value	2e-35 4BL_7039351 Best IWGSC match
DNA	ttgcctttggccaccacctccagatgaggtctccgagaagcataaagtcg Mcatccttgtctccgttccgctcaccgccacgagactcatctcctcgtac c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.