Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_RFL_Contig4416_5179910

[Submit comment/correction]

Sequence	wsnp_RFL_Contig4416_5179910
Contig	5AL_2737886
Probe	wsnp_RFL_Contig4416_5179910
DNA Homology	5AL_2737886 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 5AL_2737886 Best IWGSC match
DNA	tcttgggatctgaaggaatcgaaccttccaaagttataggaggagctatc Rtcacgactttcaccgaacttcggtgagaacccagacgtgtatgcagggg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.