Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ex_c8913_14881924

[Submit comment/correction]

Sequence	wsnp_Ex_c8913_14881924
Contig	4BS_4925666
Probe	wsnp_Ex_c8913_14881924
DNA Homology	4BS_4925666 Best IWGSC match 361 0 URGI_Best IWGSC_N
BLAST, e-value	0 4BS_4925666 Best IWGSC match
DNA	ctcctaccgccccagtgatctcagccgagaaggcttaccatgagcagctc tctgttgccgagatcaccaacagcgccttcgagccttcctccatgatggc Maagtgtgacccccgccacggcaagtacatggcctgctgcctcatgtacc gtggtgatgttgtgcccaaggatgtcaacgccgctgtggccaccatcaag a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.