Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: tplb0025f09_973

[Submit comment/correction]

Sequence	tplb0025f09_973
Contig	4DS_2275675
Probe	tplb0025f09_973
DNA Homology	4DS_2275675 Best IWGSC match 167 3e-39 URGI_Best IWGSC_N
BLAST, e-value	3e-39 4DS_2275675 Best IWGSC match
DNA	ttttcatgcatgcttcccagcaatatgccatgccttcacgcccaggagtc Rcatttgtacatccacaggattccatgcgaccatttgcacagactcacca c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.