Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_RFL_Contig3138_3094305

[Submit comment/correction]

Sequence	wsnp_RFL_Contig3138_3094305
Contig	4AL_7086621
Probe	wsnp_RFL_Contig3138_3094305
DNA Homology	4AL_7086621 Best IWGSC match 113 4e-23 URGI_Best IWGSC_N
BLAST, e-value	4e-23 4AL_7086621 Best IWGSC match
DNA	gtttcgtaggtgatcgcaaagacacaatggatgcagttcctgcggacatg Rtggtaaatgcaacgctggtagccatggctgttcatttgaatgagaaagg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.