Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TA005380-0966

[Submit comment/correction]

Sequence	TA005380-0966
Contig	4AL_7067843
Probe	TA005380-0966
DNA Homology	4AL_7067843 Best IWGSC match 97 2e-18 URGI_Best IWGSC_N
BLAST, e-value	2e-18 4AL_7067843 Best IWGSC match
DNA	cttctgcaaggagaagaaaggacgcatagccataaatctatcaaaaccgt Rcag

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.