Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_rep_c50869_1676

[Submit comment/correction]

Sequence	BobWhite_rep_c50869_1676
Contig	4AL_7166016
Probe	BobWhite_rep_c50869_1676
DNA Homology	4AL_7166016 Best IWGSC match 172 7.00005e-41 URGI_Best IWGSC_N
BLAST, e-value	7.00005e-41 4AL_7166016 Best IWGSC match
DNA	gggaggtgcgcactcccatcccatcgcatccgctccccccctctctccct Rttagcaactcctccgcccgcctctcgccggatccgccgtttctcaggaa a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.