Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 4AL_7125213

[Submit comment/correction]

Sequence	CAP11_c5598_321
Contig	4AL_7125213
Probe	CAP11_c5598_321
DNA Homology	4AL_7125213 Best IWGSC match 106 7e-21 URGI_Best IWGSC_N
BLAST, e-value	7e-21 4AL_7125213 Best IWGSC match
DNA	tatgtgcatggtggtacatatttctttactcctatcctaaggcatacacc Ratatgatatccgagaggaggaaaaaggtggccagcggtgctggagatac c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.