Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 3AS_3381477

[Submit comment/correction]

Sequence	D_contig27342_52
Contig	3AS_3381477
Probe	D_contig27342_52
DNA Homology	3AS_3381477 Best IWGSC match 313 0 URGI_Best IWGSC_N
BLAST, e-value	0 3AS_3381477 Best IWGSC match
DNA	ccgcagttcgggccggcgttgcaggaggaggccgctggtgtcgagggcga gRatgccgcatgccagatcaacccaaagcatgagatccatgtacttgatg acgccgtcccctcccctccactcccgctggcctggtgcgcctggagggca gtagagatcctggacggtccaacggcc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.