Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RFL_Contig4792_379

[Submit comment/correction]

Sequence	RFL_Contig4792_379
Contig	3B_10602431
Probe	RFL_Contig4792_379
DNA Homology	3B_10602431 Best IWGSC match 176 4.99983e-42 URGI_Best IWGSC_N
BLAST, e-value	4.99983e-42 3B_10602431 Best IWGSC match
DNA	tccaagattgtgcagaagacgttcgtcagggaggaagggcagccgacggc Rccgagcctggtggccggggagatcctgtccttcttcacgcgcaacagtt t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.