Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-1587_448

[Submit comment/correction]

Sequence	GENE-1587_448
Contig	3DS_2556613
Probe	GENE-1587_448
DNA Homology	3DS_2556613 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 3DS_2556613 Best IWGSC match
DNA	gcattgctcacaaacatagccatcgtataatcataaaaatttcagagagg Ratggagcaggagagtcaaatgaagcatacctccctcaacatattctcaa g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.