Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_RFL_Contig2338_1839077

[Submit comment/correction]

Sequence	wsnp_RFL_Contig2338_1839077
Contig	3DS_2593796
Probe	wsnp_RFL_Contig2338_1839077
DNA Homology	3DS_2593796 Best IWGSC match 97 2e-18 URGI_Best IWGSC_N
BLAST, e-value	2e-18 3DS_2593796 Best IWGSC match
DNA	ctatgaccccccctttgagaattgtcctcaacgtacctcacaatcttctc Raca

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.