Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_rep_c109320_139

[Submit comment/correction]

Sequence	RAC875_rep_c109320_139
Contig	3B_10764117
Probe	RAC875_rep_c109320_139
DNA Homology	3B_10764117 Best IWGSC match 156 7e-36 URGI_Best IWGSC_N
BLAST, e-value	7e-36 3B_10764117 Best IWGSC match
DNA	tcgacaaggaaggcggcgacggactgttctacggccttgccggccggcgg Rgggaagttctggttgccgagtccatccgaaccgtggacgaagctagcaa t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.