Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: tplb0037f15_2176

[Submit comment/correction]

Sequence	tplb0037f15_2176
Contig	3B_10702627
Probe	tplb0037f15_2176
DNA Homology	3B_10702627 Best IWGSC match 169 8e-40 URGI_Best IWGSC_N
BLAST, e-value	8e-40 3B_10702627 Best IWGSC match
DNA	ataaaatgaggctatacaggaagcagctcacaaatttgaggcatctcatc Rctacaaggatgacctttgccacacaaagaatggcaagacccttatatct c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.