Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TA004649-0518

[Submit comment/correction]

Sequence	TA004649-0518
Contig	3DS_1010407
Probe	TA004649-0518
DNA Homology	3DS_1010407 Best IWGSC match 97 2e-18 URGI_Best IWGSC_N
BLAST, e-value	2e-18 3DS_1010407 Best IWGSC match
DNA	cagaagttgaagccgtccaagtaggcggtggtgaagtagacgatgcatcc Rtag

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.