Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c48047_90

[Submit comment/correction]

Sequence	Excalibur_c48047_90
Contig	3B_10514897
Probe	Excalibur_c48047_90
DNA Homology	3B_10514897 Best IWGSC match 174 1.99993e-41 URGI_Best IWGSC_N
BLAST, e-value	1.99993e-41 3B_10514897 Best IWGSC match
DNA	gcgacgatcaacgtgaccgatctgatcagcaccggcatggagagcggcgc Rtcgcagctgaacgcggcaaagtacagcgttgtgtccgctgataactcat a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.