Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_RFL_Contig3146_3109312

[Submit comment/correction]

Sequence	wsnp_RFL_Contig3146_3109312
Contig	3DL_6896877
Probe	wsnp_RFL_Contig3146_3109312
DNA Homology	3DL_6896877 Best IWGSC match 158 2e-36 URGI_Best IWGSC_N
BLAST, e-value	2e-36 3DL_6896877 Best IWGSC match
DNA	tcagccgctctactcggagtattatagcaatgataaaggtgacaacgggg Rtcacattaaggaaattgacagtgtaggccgcattggtggcgcgcaggcc g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.