Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_RFL_Contig4734_5671036

[Submit comment/correction]

Sequence	wsnp_RFL_Contig4734_5671036
Contig	3DL_6913116
Probe	wsnp_RFL_Contig4734_5671036
DNA Homology	3DL_6913116 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 3DL_6913116 Best IWGSC match
DNA	aaccaaatgttaatttcctttcgacaagccacaatacatccgctgtatgc Racgtcccctccaaacaaataataactcagcacagcaccctctcaacagc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.