Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-2087_300

[Submit comment/correction]

Sequence	GENE-2087_300
Contig	3DL_6917880
Probe	GENE-2087_300
DNA Homology	3DL_6917880 Best IWGSC match 141 1e-31 URGI_Best IWGSC_N
BLAST, e-value	1e-31 3DL_6917880 Best IWGSC match
DNA	cctcactattgaactctgcttggttcttgccagtatgcattgaatataga Rcagtttgatgcggcaaagcaattaagg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.