Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 4DS_2289014

[Submit comment/correction]

Sequence	CAP12_c2940_354
Contig	4DS_2289014
Probe	CAP12_c2940_354
DNA Homology	4DS_2289014 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 4DS_2289014 Best IWGSC match
DNA	gaggtggaggcgacgctgaacctgaacgcgatgaaccaggcgccgaaccc Rtggcacgtgtccttctcctacgcgcgggcgctccagaacacctgcctca a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.