Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 3AS_3281852

[Submit comment/correction]

Sequence	Excalibur_c10366_58
Contig	3AS_3281852
Probe	Excalibur_c10366_58
DNA Homology	3AS_3281852 Best IWGSC match 169 8e-40 URGI_Best IWGSC_N
BLAST, e-value	8e-40 3AS_3281852 Best IWGSC match
DNA	gcgaggctcgacgccatccgcacgcgtgaagagcgtgcgtggatcactca Rgaacagtatcgttgcaacgatcattgctacatccaccagtgtgtggact c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.