Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CAP12_c1840_108

[Submit comment/correction]

Sequence	CAP12_c1840_108
Contig	6AL_5830869
Probe	CAP12_c1840_108
DNA Homology	6AL_5830869 Best IWGSC match 167 3e-39 URGI_Best IWGSC_N
BLAST, e-value	3e-39 6AL_5830869 Best IWGSC match
DNA	gtcaagaagccagacgtactacccgtcatgggtgtacaatcagctgtctc Rgcaagaggtgggtgggatctcggaggctgttggtatccatcaggtggag a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.