Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RFL_Contig4591_1330

[Submit comment/correction]

Sequence	RFL_Contig4591_1330
Contig	3AS_3291151
Species	Triticum aestivum
Probe	RFL_Contig4591_1330
DNA Homology	3AS_3291151 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 3AS_3291151 Best IWGSC match
DNA	gcgattctcgtgcttagtctgatcggcgccgggtgctggtacaagaagaa Rcggaggagaatgaccggttaccatgccgggtttgtgatgccttcaccct c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.