Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ex_c3964_7181151

[Submit comment/correction]

Sequence	wsnp_Ex_c3964_7181151
Contig	2AL_6333346
Probe	wsnp_Ex_c3964_7181151
DNA Homology	2AL_6333346 Best IWGSC match 364 0 URGI_Best IWGSC_N
BLAST, e-value	0 2AL_6333346 Best IWGSC match
DNA	catccccgccacccatcatctcaagtagcccccctcccacatcaaagtcg ccttcctcatcatcgtcgtcgttttcatccccactgtccatatcctcctc Rtcctcatcgtcaccaccatcatcaccgctgctgttacttggatcatcct cagaatccgtgtccccaagccctaaatcggtyccgaggaggacatccacg t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.