Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TA001826-1418

[Submit comment/correction]

Sequence	TA001826-1418
Contig	2DL_9864853
Probe	TA001826-1418
DNA Homology	2DL_9864853 Best IWGSC match 97 2e-18 URGI_Best IWGSC_N
BLAST, e-value	2e-18 2DL_9864853 Best IWGSC match
DNA	ctcctggaactttattgctgtcatagtctgctggatcaaggagggaggtg Rgtt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.