Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RFL_Contig5917_2433

[Submit comment/correction]

Sequence	RFL_Contig5917_2433
Contig	2DS_5345942
Probe	RFL_Contig5917_2433
DNA Homology	2DS_5345942 Best IWGSC match 117 3e-24 URGI_Best IWGSC_N
BLAST, e-value	3e-24 2DS_5345942 Best IWGSC match
DNA	ggcagattgaggatatgtgtgggatgacaaaggctgctgctgttcctgtt Rttcctgattctgaaggcaccgattcaaatccattctctcttgaagctct t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.